Review



gfp addgene 75385 plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc gfp addgene 75385 plasmid
    Gfp Addgene 75385 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+addgene+75385+plasmid/pHAGE-EFS-PCP-3XGFPnls+(Plasmid+%2375385)/pm35090599-318-104-105
    Average 93 stars, based on 10 article reviews
    gfp addgene 75385 plasmid - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    Expressing:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..

    Sequencing:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..

    Recombinant:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..

    Plasmid Preparation:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..

    Knock-In:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..

    Construct:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..

    Software:

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ..

    Article Title: Mapping the invisible chromatin transactions of prophase chromosome remodeling
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-GFP Invitrogen Cat# A-11122; RRID:AB_221569 Rabbit anti-lamin B1 Abcam Cat# ab16048; RRID:AB_443298 Rabbit anti-RPF2 Atlas antibodies Cat# HPA035475; RRID:AB_10669861 Rabbit anti-NOP58 Atlas antibodies Cat# HPA018472: RRID:AB_1854564 Rabbit anti-KNTC1 Novus Biotechnologicals Cat# NB100-88130; RRID:AB_1217831 Rabbit anti-NDC80 a gift from T. Fukagawa (Hori et al., 2003) N/A Mouse anti-histone H3 Abcam Cat# ab10799; RRID:AB_470239 Mouse anti-histone H4 Abcam Cat# ab31830; RRID:AB_1209246 Donkey anti-mouse IRDye 800CW LI-COR Biosciences Cat# 926-32212; RRID:AB_621847 Donkey anti-rabbit IRDye 800CW LI-COR Biosciences Cat# 926-32213; RRID:AB_621848 Chemicals, peptides, and recombinant proteins 13C6, 15N2-L-lysine:2 HCl Sigma-Aldrich Cat# 608041 13C6, 15N4-L-arginine:HCl Sigma-Aldrich Cat# 608033 Fetal Bovine Serum BioSera Cat# FB1090 Dialyzed FBS (mol wt cut-off, 10,000) Sigma-Aldrich Cat# F0392 penicillin/streptomycin GIBCO Cat# 15140148 RPMI1640 GIBCO Cat# 21875034 RPMI1640 for SILAC Thermo Scientific Cat# 88365 Chicken Serum GIBCO Cat# 16110082 1NM-PP1 a gift from J. Paulson N/A PIPES Sigma-Aldrich Cat# P1851 hygromycin B GIBCO Cat# 10687010 G418 GIBCO Cat# 10131035 formaldehyde Pierce Cat# 28908 JF549 halo ligand a gift from L. Davis (Chong et al., 2018) N/A SiR DNA Spirochrome Cat# SC007 Hoechst 33342 Invitrogen Cat# H21492 Trypsin Pierce Cat# 90057 Critical commercial assays Quant-iT dsDNA assay kit HS Invitrogen Cat# Q33120 NEON transfection System 100 ml kit Invitrogen Cat# MPK10096 Deposited data Mass spectrometry raw data This paper PRIDE: PXD026385 Immunoblotting This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Microscopy images This paper; Mendeley Data https://data.mendeley.com/datasets/ bxkkp6bv2j/3 Experimental models: Cell lines Chicken DT40 cells ATCC CRL-2111 Experimental models: Organisms/strains DT40 cell lines with CDK1as allele Gibcus et al., 2018; Samejima et al., 2018 N/A DT40 cell lines expressing Halo-lamin B1 This paper N/A (Continued on next page) Molecular Cell 82, 696–708.e1–e4, February 3, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER DT40 cell lines expressing Halo-lamin B1and 3xGFP-NLS This paper N/A DT40 cell lines expressing LBR-Clover This paper N/A Oligonucleotides double strand oligos encoding BP-NLS: (tcgagaagcgcgtaaccgcagcggg catcacgcatccaaagaaaaag cggaaagtgtaagggcc and cttacactttccgctttttctttgga tgcgtgatgcccgctgcggttacgcgcttc) This paper N/A guide RNA sequence targeting Lamin B1: TCCCCTACCATCACGTCACG This paper N/A guide RNA sequence targeting LBR: TGCTGAAGCACTCCATCGTT This paper N/A Recombinant DNA Cas9 expressing plasmid pX330 Addgene 42230 knockin construct to insert a Halo tag at the N terminus of the lamin B1 gene This paper N/A knockin construct to insert Clover in front of the stop codon in the LBR gene This paper N/A Plasmid: 3Xsuperfolding GFP Addgene 75385 Plasmid: 3Xsuperfolding GFP and NLS This paper N/A Plasmid: pcDNA3 Invitrogen; Addgene N/A Software and algorithms MaxQuant Cox and Mann, 2008; http://coxdocs.org/ version 1.6.7.10 Perseus Tyanova et al., 2016; http://coxdocs.org/ version 1.6.0.7 R https://cran.r-project.org version 3.6.3 Image Studio LI-COR Biosciences version 5.2 Fiji Schindelin et al., 2012; https://fiji.sc version 2.1.0/1.53c softWoRx software Applied Precision Inc, lmage Solutions UK Ltd version 7.0.0 Code for R Shiny app for interactive online resource This paper https://github.com/kustatscher-lab/ mitoChEP-Shiny-App Other An interactive online resource for analyzed data This paper https://mitochep.bio.ed.ac.uk ll OPEN ACCESS Resource ..



    Similar Products

    gfp addgene 75385 plasmid  (Addgene inc)
    93
    Addgene inc gfp addgene 75385 plasmid
    Gfp Addgene 75385 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+addgene+75385+plasmid/pHAGE-EFS-PCP-3XGFPnls+(Plasmid+%2375385)/pm35090599-318-104-105
    Average 93 stars, based on 1 article reviews
    gfp addgene 75385 plasmid - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results